MystiCq microRNA qPCR Control Primer, SNORD47

Code: mircp00006-250rxn D2-231

Not available outside of the UK & Ireland.

Features and Benefits

Features and Benefits Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs Extensive desi...


read more

Your Price
£115.00 EACH

Not available outside of the UK & Ireland.

Features and Benefits

Features and Benefits Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence No self-complementarity or primer dimer artifacts with the Universal PCR Primer Optimized primer Tm designed to match the Universal PCR Primer Universal cycling conditions ensures robust amplification for all assays in profiling experiments Optimized PCR product Tm (75-78° C)

General description

The MystiCq microRNA qPCR Control Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific small RNAs with the MystiCq Universal PCR primer and the MystiCq microRNA SYBR Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix.

Legal Information

GenBank is a registered trademark of United States Department of Health and Human Services

MystiCq is a registered trademark of Qiagen Beverly Inc.

concentration10 mg/mL
formliquid
GenBank® mature/minor accession no.NR_002746.1
Gene Informationhuman ... SNORD47(26802)
mature sequenceAACCAAUGAUGUAAUGAUUCUGCCAAAUGAAAUAUAAUGAUAUCACUGUAAAACCGUUCCAUUUUGAUUCUGAGGUU
mp~80 °C
shipped inwet ice
storage temp.−20°C
This product has met the following criteria: