MystiCq microRNA qPCR Assay Primer, hsa-miR-663a

Code: mirap00656-250rxn D2-231

Not available outside of the UK & Ireland.

Features and Benefits

Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs Extensive design and testing of olig...


read more

Your Price
$129.34 EACH

Not available outside of the UK & Ireland.

Features and Benefits

Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence No self-complementarity or primer dimer artifacts with the Universal PCR Primer Optimized primer Tm designed to match the Universal PCR Primer Universal cycling conditions ensures robust amplification for all assays in profiling experiments Optimized PCR product Tm (75-78° C)

General description

The MystiCq® microRNA qPCR Assay Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific microRNAs with the MystiCq Universal PCR primer and the MystiCq® microRNA SYBR® Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.

Legal Information

SYBR is a registered trademark of Life Technologies

ReadyMix is a trademark of Sigma-Aldrich Co. LLC

MystiCq is a registered trademark of Qiagen Beverly Inc.

Other Notes

Formerly hsa-miR-663.

concentration10 mg/mL
formliquid
Gene Informationhuman ... RELL1(768211)
mature sequenceAGGCGGGGCGCCGCGGGACCGC
mp~77 °C
Sanger mature/minor accession no.MIMAT0003326
shipped inwet ice
storage temp.−20°C
This product has met the following criteria: